Tagr 5 1 0 Mm

broken image


596-12170 - For high contrast identification labelling in warehouse areas, this continuous length label material gives the user the ability to print large sized text and barcodes and cut to length after printing with either a supplied in-line cutter with the TT4000 or by hand with the TT430. 596-12170 - For high contrast identification labelling in warehouse areas, this continuous length label material gives the user the ability to print large sized text and barcodes and cut to length after printing with either a supplied in-line cutter with the TT4000 or by hand with the TT430. Using these products across the company ensures that all marking is to a consistent and professional. 596-12170 - For high contrast identification labelling in warehouse areas, this continuous length label material gives the user the ability to print large sized text and barcodes and cut to length after printing with either a supplied in-line cutter with the TT4000 or by hand with the TT430.

  1. Tagr 5 1 0 Mm Ring Scale
  2. Tagr 5 1 0 Mm Equals
  3. 5 1 Height Cm

Warehouse and Pipe Labelling for Thermal Transfer Printing 101.6 mm redArticle number: 596-12168

  1. Compared to the TAG Device (2.2 ± 1.7 mm vs. 4.4 ± 3.0 mm, P 0.05). Also, while birdbeaking was seen in 8 of 20 cases. Accurate deployment was defined as 5 mm of distance from the intended.
  2. Download TAGR - T-adapter with 60° cone end and BSPP male thread according to ISO 8434-6 / BS 5200 of stainless steel 316Ti. Available for SOLIDWORKS, Inventor, Creo, CATIA, Solid Edge, autoCAD, Revit and many more CAD software but also as STEP, STL, IGES, STL, DWG, DXF and more neutral CAD formats.

To use the watchlist, please login or register:

Features

  • Pipe, warehouse and shelving label
  • Supplied on a continuous roll and cut by hand or automated with printer cutters
  • Also for rough surfaces
  • Good resistance in outdoor applications

Application

These coloured labels are used to identify storage systems with barcode and location information. They are also suitable for general marking of parts and components, samples and blocked goods in quality assurance, storage boxes and barrels.

More products in this product group

Warehouse and pipe labelling, thermal transfer >
Application ToolTT431, TT4030
ColourRed (RD)
Features and BenefitsContinuous length label material in a range of high visibility colours gives the user the ability to print large sized text and barcodes for use in industrial pipe marking areas. The label can be cut to length after printing with a supplied in-line cutter with the TT4000 or by hand with the TT420. Using these products across the company ensures that all marking is to a consistent and professional standard.For problem-free printing, we recommend TagPrint Pro software, TT4000+ and TT420 printers. Use ribbon TT822OUT for yellow and white material, and ribbon TTRW for green and red material.
Pack Content50m
Package Quantity perreel
PART DESCRIPTIONTAGR1TD-1213-RD-1213-RD
Product FamilyHelatag 1213
Product GroupWarehouse and pipe labelling, thermal transfer
Self adhesive (Yes/No)Yes
Height (H)50.00m
Length (L)50.00m
Print MethodThermal transfer printing
Thickness (T)66.0µm
Thickness of Foil95µm
Thickness of foil test methodISO 534
Width (W)101.60mm
Width of Liner (WL)101.60mm
AdhesiveAcrylic
Chem. Material PropertiesResistant to water, alcohol, most oils, greases, fuel, aliphatic solvents, weak acids, salts and alkalis.
Curing Temperaturefrom +8 °C
ELV compliant (Article 4 - 2)YES
HalogenfreeNo
Hazardous goodNo
Initial tack16N/25 mm
Initial tackFINAT FTM 1
MaterialType 1213, Vinyl, glossy colours (1213)
Material1213
Mech. material propertiesDue to its flexibility and adhesiveness the material is also suitable for rough surfaces.
Operating Temperature - °C-40 °C to +90 °C
Peel strength27 N/15 mm
Peel strength test methodDIN 53455-5
Recommended Ribbon TypeTT822OUT, TTRW
Shear strength1.5
Shear strength test methodDIN 53455-5
Shelf LifeMinimum 1 year upon receipt / maximal 2 years after production date.
Specifications
EAN / GTIN-134031026295534
Labels per Row1pc.
Packaging 1 - Height (m)0.116m
Packaging 1 - Length (m)0.15m
Packaging 1 - Qty50
Packaging 1 - Typebag
Packaging 1 - Volume (m³)0.00271
Packaging 1 - Weight (kg)0.3kg
Packaging 1 - Width (m)0.156m
Storage Temperature+21 °C
Weight0.3kg
  • TT4030556-04037
    Thermal transfer printer
  • TT431556-00400
    Thermal transfer printer

    To use the watchlist, please login or register:

  • TT822OUT556-00101
    Thermal Printer Ribbons for adhesive labels
  • TT822OUT8556-00161
    Thermal Printer Ribbons for heatshrink

    To use the watchlist, please login or register:

  • TAGR4TD1-1213-YE596-03103
    Warehouse and pipe labelling, thermal transfer
  • TAG108TD1-1213-GN596-12166
    Warehouse and pipe labelling, thermal transfer

    Multitouch 1 15 2. To use the watchlist, please login or register:

  • TAG108TD1-1213-YE596-12167
    Warehouse and pipe labelling, thermal transfer
  • TAG108TD1-1213-BU596-12181
    Warehouse and pipe labelling, thermal transfer

    Snipper app 1 3 2. To use the watchlist, please login or register:

  • TAG108TD1-1213-GY596-12188
    Warehouse and pipe labelling, thermal transfer
  • TAG108TD1-1213-PK596-00971
    Warehouse and pipe labelling, thermal transfer

    To use the watchlist, please login or register:

  • TAGR1TD-1213-YE596-12169
    Warehouse and pipe labelling, thermal transfer
  • TAGR1TD-1213-GN596-12170
    Warehouse and pipe labelling, thermal transfer

    To use the watchlist, please login or register:

  • TAGR1TD-1213-WH596-12171
    Warehouse and pipe labelling, thermal transfer
Published online 2015 Apr 6. doi: 10.3732/apps.1400121
PMID: 25909043
This article has been cited by other articles in PMC.

Abstract

Premise of the study:

Microsatellite markers were developed for the common arid Australian shrub Acacia ligulata (Fabaceae) and the threatened overstory trees A. melvillei and A. pendula.

Tagr

Methods and Results:

DNA sequence data generated by 454 sequencing were used to identify microsatellite nucleotide repeat motifs. Including previously developed primer sets, we report on the development of 10 polymorphic microsatellite loci for each species. Six of these were novel for A. melvillei and A. ligulata, and five were novel for A. pendula, while five more each were transferred from primers developed for related species (A. carneorum and A. loderi). We found three to 17 alleles per locus for each species, with high multilocus genotypic diversity within each of two A. ligulata and A. pendula stands, and one A. melvillei population. A second A. melvillei stand appeared to be monoclonal.

Conclusions:

These markers will allow assessment of population genetics, mating systems, and connectedness of populations of these and possibly other arid-zone acacias.

Keywords: Acacia, Fabaceae, genetic diversity, perennial plant, recruitment failure, sexual and asexual reproduction

Several Australian arid-zone acacias are threatened by habitat loss, degradation, and fragmentation resulting from agricultural activities and exotic herbivores (Morton et al., 1995), although others, including Acacia ligulata A. Gtasks pro 1 3 5 – tasks for google docs. Cunn. ex Benth., are thriving. Two long-lived and potentially clonal species facing a variety of potential threats are A. melvillei Pedley and A. pendula A. Cunn. ex G. Don. Both of these latter species likely suffer from infrequent seed production and chronic recruitment failure (Batty and Parsons, 1992). Moreover, there is some debate about the origin and taxonomy of stands of A. pendula found in the Hunter region of New South Wales (Bell et al., 2007), the extreme eastern range edge of its distribution and a notable anomaly for this species, given its predominate semiarid/arid distribution in four Australian states. A clear understanding of the factors underlying the variation in the performance of these three species is hampered by a lack of genetic tools that allow assessment of the mating and dispersal and genetic diversity of remaining stands.

The three target species have partially overlapping ranges. 'Acacia melvillei shrubland' endangered ecological community occurs in semiarid and arid eastern Australia. This community is considered threatened primarily because of senescence of the overstory (dominated by A. melvillei), infrequent seed set, and recruitment failure due to overgrazing (NSW Scientific Committee, 2008). Acacia pendula is more widespread, occurring throughout the eastern semiarid zone, but is considered threatened within the Hunter Valley (NSW Scientific Committee, 2008). In contrast, A. ligulata is one of the most widespread Acacia species, occurring throughout arid Australia. Seed set occurs annually in this species, recruits are common (personal observation), and most stands appear to be thriving (personal observation). For each of these species, we developed primers that amplify microsatellite loci. By comparing and contrasting the genetic structure of populations of these species with partially overlapping distributions and perceived variation in reproductive success, we aim to gain insights into the impact of anthropogenic disturbance on their genetic structure and diversity and, together with demographic assessments, will seek to use these data to predict the resilience of remaining stands.

METHODS AND RESULTS

We used GS FLX Titanium sequencing (Roche Diagnostics Corporation, Sydney, Australia) to generate databases of DNA sequences for A. melvillei and A. pendula. Specimens of each species were sourced from stands located in western New South Wales. Genomic DNA was extracted using a DNeasy Plant Mini Kit (QIAGEN, Melbourne, Australia). Multiple DNA extracts from the same individual were pooled to obtain 5 μg of high-molecular-weight DNA for library construction. The library was prepared in accordance with the manufacturer's instructions (Roche Diagnostics Corporation), and the sequencing was performed at the Otago Genomic Sequencing Unit, University of Otago, New Zealand, using the GS FLX system with the GS FLX Titanium Rapid Library Preparation Kit (catalog no. 05608228001; Roche Diagnostics Corporation). Upon receipt of the DNA sequence databases from the University of Otago, we used the program MSATCOMMANDER version 0.8.1 () to detect DNA sequences containing di-, tri-, and tetranucleotide repeats, and to design microsatellite primers for PCR assays.

To PCR amplify loci of interest, we used Multiplex-Ready Technology. This method was developed by and is briefly described below. For each species, 24 locus-specific primer sets were synthesized by Sigma-Aldrich (Sydney, Australia). We also made use of existing primers (obtained in the same way) that amplify microsatellite loci in A. carneorum Maiden and A. loderi Maiden (Roberts et al., 2013) to potentially increase the number of microsatellites available for use in A. melvillei, A. pendula, and A. ligulata. Each respective forward and reverse primer had the nucleotide sequence 5′-ACGACGTTGTAAAA-3′ and 5′-CATTAAGTTCCCATTA-3′ attached to its 5′-end. Tag primers, tagF (5′-ACGACGTTGTAAAA-3′) and tagR (5′-CATTAAGTTCCCATTA-3′), were also synthesized, with tagF 5′-end labeled with one of Applied Biosystems' (Carlsbad, California, USA) proprietary fluorescent dyes (VIC, FAM, NED, and PET). Each PCR assay contained 0.2 mM dNTP, 1× ImmoBuffer (Bioline, Alexandria, Australia), 1.5 mM MgCl2, 100 ng/μL bovine serum albumin (BSA; Sigma-Aldrich), 75 nM each of dye-labeled tagF and unlabeled tagR primer, 0.15 units of Immolase DNA polymerase (Bioline), and 2 μL of genomic DNA (∼10 ng/μL). The optimal primer concentration of each forward and reverse locus-specific primer was determined in preliminary PCR assays varying the primer concentration between 5 and 120 nM (Table 1) and also was included within each 10 μL (total volume) assay. PCRs were conducted on either a Bio-Rad (Hercules, California, USA) or Eppendorf (Hamburg, Germany) thermocycler with a denaturing step at 95°C, primer annealing step of 63°C, and an extension step at 72°C repeated for 40 cycles. Genomic DNA was extracted from phyllodes from one individual from each of five stands across the range of each species using a standard cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). For each species, we genotyped eight individuals separated by at least 10 m, from each of five stands separated by at least 30 km. This initial sampling allowed us to assess levels of polymorphism within and between stands, before primers were deemed sufficiently polymorphic to characterize population genetic structure.

Table 1.

https://dwza.over-blog.com/2021/02/tuxera-ntfs-for-mac-2012-3-6-ubserial-download-free.html. Novel microsatellite loci for Acacia melvillei, A. ligulata, and A. pendula.a

LocusbPrimer sequences (5′–3′)Repeat motifFluorescent dyePrimer conc. (nM)Allele size range (bp)Cross-species amplificationcGenBank accession no.
A. melvillei
 CPUH4AcF: AGATGCATTGACTGAGACGG(AT)136-FAM40112–115Al, Alig, ApKF776129
R: CGAATGAAGGAGATTTATGAAGAGAC
 C51M0AmF: CTGCAAATCGTTTCTTCAAGCC(CTTT)66-FAM20175–182Al, Ac, Alig, ApKF776130
R: ACAGAAATGAGCATGACCCC
 BBY8PAlF: TTGGCAAATCCGCACAGTC(GT)11VIC20126–146Ac, Alig, ApKF776131
R: TGCCATCGCAACATATAGCTTC
 AV9GRAlF: CCAACGACAGTGGGCAGTC(AT)14PET10185–200Ac, Alig, ApKF776132
R: CTCCGGTGTTAGCAAAGGC
 BA1R8AmF: GGTGCTTTTCCCCACCTTC(GAA)8NED10245–258Al, Ac, Alig, ApKF776133
R: TCTCGCTTTTCATGTGCAAG
 CIDYFAmF: CACACTTATGGGATGGGTTGC(AAT)14VIC20290–340Al, Ac, Alig, Ap
R: AGCTAAGGAAAGTGTACGGGAAT
A. ligulata
 BVWHYAcF: TCCTACTTCCCCAACACGC(AT)126-FAM60192–235Am, Al, ApKF776134
R: ACAAGCAGCCATTGGAAGG
 APZIZAcF: ACACTACACTCACAACACACAC(AC)11VIC20222–250Am, Al, ApKF776135
R: ACACGGTTTGCTTGGCTTG
 A47K4AcF: CGAATCGGGAGAGTGGGAG(AT)106-FAM20228–252Am, Al, ApKF776136
R: ACCCAACCCAGTCCAATCC
 BBY8PAlF: TTGGCAAATCCGCACAGTC(GT)11PET20139–159Am, Ac, ApKF776131
R: TGCCATCGCAACATATAGCTTC
 AO12CAcF: AAAACAAGAGAAGAGGACATGC(AT)126-FAM20280–350Am, Al, ApKF776128
R: TCGTAGAAACGACACGAAACG
 CU0EQAmF: ACCACCATCTTCACCTCCAC(GGGA)76-FAM40190–220Al, Ac, ApKF776137
R: TCCGGCGTTTCCAACTAAC
A. pendula
 ACPU7AlF: GTTCTACGGCTAGATGGTGC(AC)12(AT)10PET20151–191Am, Ac, AligKP161852
R: TGTCATACGGCCTCACAAAG
 BA1R8AmF: GGTGCTTTTCCCCACCTTC(GAA)8VIC20240–256Al, Ac, AligKF776133
R: TCTCGCTTTTCATGTGCAAG
 BBY8PAlF: TTGGCAAATCCGCACAGTC(GT)11VIC20135–173Am, Ac, AligKF776131
R: TGCCATCGCAACATATAGCTTC
 C51M0AmF: CTGCAAATCGTTTCTTCAAGCC(CTTT)6NED20170–190Al, Ac, AligKF776130
R: ACAGAAATGAGCATGACCCC
 CYD8IApF: GACCTCAAGCAAGACAAGCC(AC)22NED40426–454Al, AcKP161853
R: ACAACGCTGCTCATACATGC
 DBGX4ApF: CCTCCTCCCTTATTCCCTCAC(AG)10PET40239–273Al, AcKP161854
R: AGAAGGCGATATGGACACCG
 DNZTAApF: TGTCCACACAGAACCCGTC(AG)106-FAM40171–221Al, AcKP161855
R: AGAGGCTCCGAAATCCAAGG
 C2Q63ApF: TGCACAGTTCTAGGCTTCCC(AT)11VIC60177–225Al, AcKP161856
R: ACCCAAACCACCTACACCTC
 DE1HPApF: GCGGAGGTAGAAGGAGAGTC(AAT)9PET40167–203Al, AcKP161857
R: GCTCACGCCACAAGTATGAC
bLoci discovered in A. melvillei, A. loderi, A. carneorum, and A. pendula 454 sequencing data sets are identified as follows: A. melvillei = Am, A. loderi = Al, A. carneorum = Ac, A. pendula = Ap.
cLoci that were successfully cross-amplified in A. melvillei (Am), A. loderi (Al), A. carneorum (Ac), A. ligulata (Alig), and A. pendula (Ap), but not found to be as robust as other loci, or polymorphic enough for further use.

We developed new polymorphic primers that had consistently clean profiles, six each for A. melvillei and A. ligulata, and five for A. pendula (Table 1). We were also able to cross-transfer 15 previously optimized loci, 11 of which are described in Roberts et al. (2013). Specifically, five of 11 primer sets amplified successfully and had equally clear profiles on electropherograms for A. melvillei (DCL0C, AO35A, DSGN5, BNQS6, and DZ7O9), A. ligulata (A4IKI, AQBUV, DCL0C, ARU19, and C03P6), and A. pendula (ACPU7, BAIR8, BBY8P, C5IMO, and DCLOC), respectively. This resulted in a total of 11 working primers each for A. melvillei and A. ligulata, and 10 for A. pendula. All other primers tested did not amplify consistently or were difficult to score because of complex stuttering of the amplified product. These primer sets were discontinued. Combinations of successful primers were trialed together in multiplex PCRs to look for repeatable and clean assays. Successful combinations of primers as multiplex PCRs, which were subsequently used for all further genotyping, are presented in Table 2.

Table 2.

Multiplex PCR combinations achieved and fluorescent dyes used. https://download-desert.mystrikingly.com/blog/image-vectorizer-v1-3-download-free. Primers listed in Table 1 but absent here were not successfully multiplexed.

SpeciesMultiplex PCR combinationsMultiplex no.Fluorescent dye
Acacia melvilleiCPUH4 / C5IM0 / BNQS61FAM
BBY8P / DZ7O9 / CIDYF2VIC
AV9GR / BAIR83PET
DCL0C / DSGN54NED
Acacia ligulataDCL0C / BVWHY / AO12C1FAM
C03PC6 / APZIZ2VIC
BBY8P / A4IKI3NED
Acacia pendulaBBY8P / BAIR81FAM

Following our initial screening of loci described above, we preceded to genotype plants from two New South Wales populations of each species (A. melvillei: AMEL1, AMEL2; A. ligulata: ALIG1, ALIG2; A. pendula: APEN1, APEN2; Appendix 1) using 10 of the primer pairs developed for each plant species (Tables 35). All loci amplified consistently in duplicate PCR assays and were polymorphic with between three and 17 alleles per locus.

Tagr 5 1 0 Mm Ring Scale

Table 3.

Levels of genetic diversity and expected genotypic diversity for a nonclonal population of Acaciamelvillei.

AMEL2 (N = 30)
LocusAHeaFIS
CPUH4_a40.710.48
C5IMO_a50.440.54
BBY8P_a80.540.23
DZ709_a180.900.31
AV9GR_a80.800.59
BAIR8_a60.550.20
DCLOC_a90.810.49
DSKN5_a130.860.23
CIDYF_a90.720.40
AO35A_a90.680.36
Average across all loci8.9 ± 1.290.70 ± 0.050.38 ± 0.04

Note: A = number of alleles per locus; FIS = inbreeding within populations; He = expected heterozygosity; N = number of individuals sampled.

aSignificant deviation from Hardy–Weinberg equilibrium for all loci at P < 0.05.

Table 5.

Levels of genetic diversity and expected genotypic diversity for two nonclonal populations of Acacia pendula.

APEN1 (N = 30)APEN2 (N = 30)
LocusAHeaFISAHeaFIS
ACPU7120.861*0.303100.793*0.370
BA1R830.633*0.68430.593**0.606
BBY8P150.898***0.109100.816NS−0.063
C51M050.634NS−0.15730.559***−0.311
DCL0C100.850*0.569100.788NS−0.016
CYD8I70.807*0.44580.651NS0.129
DBGX490.867NS0.039110.818NS−0.100
DNZTA80.782NS0.10590.696*0.569
C2Q6390.808NS0.09270.616***0.189
DE1HP70.718*0.42440.559NS0.285
Average across all loci8.5 ± 1.10.786 ± 0.030*0.261 ± 0.0847.5 0.689 ± 0.034* 1.00.689 ± 0.034*0.166 ± 0.094

Note: A = number of alleles per locus; FIS = inbreeding within populations; He = expected heterozygosity; N = number of individuals sampled; NS = not significant.

aSignificant deviations from Hardy–Weinberg equilibrium at *P < 0.001, **P < 0.01, ***P < 0.05.

Table 4.

Levels of genetic diversity and expected genotypic diversity for two nonclonal populations of Acacia ligulata.

ALIG1 (N = 30)ALIG2 (N = 30)
LocusAHeaFISAHeaFIS
DCLOC_a110.850.2060.790.39
BVWHY_a70.770.4250.290.43
CU3P6_a110.860.34100.850.55
AP212_a100.860.3090.840.35
BBY8P_a160.910.27150.900.39
A4IKI_a40.630.2760.610.40
AQBUV_a150.880.2090.810.62
A47K4_a80.750.4240.450.53
CU0EQ_a100.800.3080.710.45
AO12C_a100.820.2880.670.49
Average across all loci10.2 ± 1.110.81 ± 0.020.29 ± 0.048.0 ± 0.990.69 ± 0.060.47 ± 0.04

Note: A = number of alleles per locus; FIS = inbreeding within populations; He = expected heterozygosity; N = number of individuals sampled.

aSignificant deviation from Hardy–Weinberg equilibrium for all loci at P < 0.05.

Because A. melvillei reproduces both sexually and asexually, we used GenClone to estimate the probability that n (where n = 1, 2, 3…i) copies of a multilocus genotype were produced by distinct episodes of sexual reproduction, Psex (Arnaud-Haond and Belkhir, 2007). Where Psex is less than 0.05, it is improbable that n multilocus genotype copies were derived by sex alone.

All 30 plants in AMEL1 were identical, which far exceeds the maximum number of replicates of that genotype (n = 7) that is expected to result from sexual reproduction (Psex= 0.073) with all replicates of n > 7 identical genotypes associated with Psex values less than 0.05. In contrast, we detected 26 distinct genets in AMEL2, and it was improbable that the n = 4 replicated genotypes were produced by independent episodes of sexual reproduction (Psex < 0.001), implying that while the vast majority of distinct genotypes in this stand were founded sexually, the replicate genotypes were produced by asexual reproduction. All A. pendula and A. ligulata plants were genetically distinct, with the exception of one pair in ALIG2. Levels of genetic diversity and expected genotypic diversity expressed as the average number of alleles per locus (A) and expected heterozygosity (He), respectively, were generally high for AMEL2, APEN1, APEN2, ALIG1, and ALIG2 (Table 2). However, average inbreeding within populations (FIS) scores across all loci indicated significant deficits of heterozygotes in all five populations, suggesting inbreeding is a common phenomenon in these species (Tables 35). None of the pairwise tests for linkage equilibrium revealed significant associations between loci (P > 0.05).

CONCLUSIONS

These polymorphic markers have proved effective in estimating levels of genetic diversity within populations of these three acacias (A. pendula, A. ligulata, and A. melvillei) and partitioning of variation within and among populations. Moreover, these primer sets can be used to compare levels of genetic diversity and structure within species as part of the process of investigating reproductive failure in A. melvillei and A. pendula. The amplification of DNA extracted from adult leaf material and the embryo of seeds enables estimation of mating system parameters and the assessment of the relative past contributions of sexual and asexual reproduction within and among populations and species. In this initial study, we found evidence of inbreeding in all three species, suggesting a history of isolation. We also identified a high degree of clonality in one population of A. melvillei, a phenomenon which, if widespread, may influence the choice of conservation actions. For the threatened A. melvillei, further landscape-level assessment of genetic diversity and structure, across a wider range of populations, will allow us to estimate historic levels of connectivity, identify populations containing novel genotypes, and assess the suitability of strategies such as genetic rescue. Ultimately, such strategies will inform management via translocation or augmentation. Our success in cross-amplifying markers among Acacia species implies that at least some of these primers will be transferable to other acacias. This study represents the first attempt to characterize the genetic structure of these three important overstory Acacia species.

Appendix 1.

Voucher and location information for Acacia spp. Audio assault bulldozer 1 2 download free. populations used in this study. All vouchers were deposited in the Janet Cosh Herbarium at the University of Wollongong, Australia.

Tagr 5 1 0 Mm Equals

Population referenceSpeciesCollection dateLocalityGeographic coordinatesNVoucher no.Herbarium ID
ALIG1Acacia ligulata25 September 2013Big Dune, Kinchega National Park, New South Wales32.53235°S, 142.16016°E30AJD35510843
ALIG2Acacia ligulata25 September 2013Near Lake Menindee, Kinchega National Park, New South Wales32.37642°S, 142.39462°E30AJD35610844
AMEL1Acacia melvillei6 January 201238 km SSW Barnato Lake on Tilpa Rd., New South Wales31.93420°S, 144.87594°E30AJD34510842
AMEL2Acacia melvillei15 September 20105 km W of Emmdale on the Barrier Hwy., New South Wales31.66016°S, 144.25639°E30AJD33610845
APEN1Acacia pendula2 March 20106 km NW of Tharbogang on road to Tabbita, New South Wales34.20632°S, 145.95525°E30N/A11111
APEN2Acacia pendula10 March 201030 km E of Hay on Sturt Hwy., New South Wales34.50677°S, 145.17246°E30AJD30911099

LITERATURE CITED

  • Arnaud-Haond S., Belkhir K.2007. GENCLONE: A computer program to analyse genotypic data, test for clonality and describe spatial clonal organization. Molecular Ecology Notes7: 15–17. [Google Scholar]
  • Batty A., Parsons R.1992. Regeneration of Acacia melvillei in part of semi-arid south-eastern Australia. Proceedings of the Royal Society of Victoria104: 89–97. [Google Scholar]
  • Bell S., Peake T., Driscoll C.2007. Dealing with taxonomic uncertainty in Weeping Myall Acacia pendula from the Hunter catchment, New South Wales. Australasian Plant Conservation16: 14–15. [Google Scholar]
  • Doyle J. J., Doyle J. L.1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin19: 11–15. [Google Scholar]
  • Faircloth B.2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources8: 92–94. [PubMed] [Google Scholar]
  • Hayden M. J., Nguyen T. M., Waterman A., Chalmers K. J.2008. Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping. BMC Genomics9: 80. [PMC free article] [PubMed] [Google Scholar]
  • Morton S., Stafford Smith D., Friedel M., Griffin G., Pickup G.1995. The stewardship of arid Australia: Ecology and landscape management. Journal of Environmental Management43: 195–217. [Google Scholar]
  • NSW Scientific Committee. 2008. Final Determination: Acacia melvillei Shrubland in the Riverina and Murray-Darling Depression bioregions–endangered ecological community. Website http://www.environment.nsw.gov.au/determinations/acacamelvilleiFD.htm [accessed 13 December 2013].
  • Roberts D. G., Forrest C. N., Denham A. J., Ayre D. J.2013. Microsatellite markers for vulnerable Australian aridzone Acacias. Conservation Genetics Resources5: 199–201. [Google Scholar]

5 1 Height Cm

Articles from Applications in Plant Sciences are provided here courtesy of Wiley-Blackwell




broken image